Everything below concerns ACTH(4-10). We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Updated 2025-12-21. Numbers and descriptions here follow the published literature rather than marketing material.
Verification of a supplied batch generally combines a certificate of analysis with independent testing, because certificates are self-reported documents. A typical package includes a chromatographic trace, a mass spectrum, and a stated water or counter-ion content. Batch-to-batch consistency matters more than a single purity figure when results are compared across experiments. No single mandatory standard governs research-grade peptide release, so laboratories are expected to define their own acceptance criteria. Residual trifluoroacetate from purification is a frequently overlooked counter-ion.
Lyophilized material is chemically stable for extended periods when kept dry, cold, and protected from light. The powder is hygroscopic, so vials should be warmed to room temperature before opening to reduce condensation on the contents. Once dissolved, the peptide is far less stable because peptide bonds are susceptible to hydrolysis and the methionine residue can oxidize. Solutions are typically aliquoted and held at 2-8 °C for short intervals or frozen for longer ones, and repeated freeze-thaw cycles should be avoided.
Regulatory status varies sharply by country. Semax is registered for medical use in Russia, where it appears in formularies as a nasal solution, and it also holds registration in a small number of neighbouring states. It has no approval from the United States Food and Drug Administration or the European Medicines Agency, and it is not a scheduled controlled substance in most jurisdictions. Elsewhere it circulates mainly as laboratory material, so purity documentation comes from suppliers rather than from a national pharmacopoeia.
Semax is a synthetic peptide created in the Soviet Union during the early 1980s by researchers working in Moscow. It was built from the short adrenocorticotropic hormone fragment known as ACTH(4-10), and the chain was then extended with three additional amino acids. The resulting molecule was named semax and entered clinical use in Russia in 1994. It is generally described as a nootropic and neuroprotective agent rather than as a hormone analogue.
| Property | Value | Notes |
|---|---|---|
| Typical purity | 95% or higher | By reversed-phase HPLC area |
| Identity method | Electrospray mass spectrometry | Confirms molecular mass |
| Purity method | Reversed-phase HPLC | Detection near 214 nm |
| Primary degradation | Methionine oxidation | Sulfoxide product, +16 Da |
| Solution storage | 2-8 °C, short term | Aliquot to avoid freeze-thaw |
Pharmacokinetic accounts emphasize rapid breakdown. After intravenous dosing the intact peptide disappears from blood within minutes, and nasal delivery produces low but measurable concentrations. Metabolites rather than the parent molecule may account for part of the observed activity, although the relative contribution is unresolved. Dosing in the literature varies widely and no optimal schedule has been agreed. These gaps are regularly cited as a reason the findings have not produced broad clinical adoption beyond the original research setting.
Proposed mechanisms center on neurotrophic signaling rather than on classical melanocortin receptor activation. Rodent experiments have reported shifts in the expression of brain-derived neurotrophic factor and nerve growth factor after administration, together with changes in the associated receptor systems. Several authors argue that the peptide acts largely through its degradation products and their interaction with peptidergic pathways, but this remains a hypothesis rather than a settled finding. No single molecular target has been identified in a way that the field broadly accepts.
Published research covers ischemic stroke, traumatic brain injury, cognitive impairment, optic nerve conditions and attention-related measures. Much of the human evidence comes from small trials conducted in one country, which limits how far the results generalize. Animal models supply the larger share of the data, and effects seen in rodents do not transfer automatically to people. Reviews have noted that methodological reporting is often incomplete, making it difficult to pool results or compare treatment schedules across studies.
The C-terminal Pro-Gly-Pro extension is not incidental. Proline-rich tails are known to resist several common peptidases, and the published literature attributes the longer half-life of Semax, relative to unmodified ACTH fragments, to this feature. The modification also removes the melanocyte-stimulating and corticosteroidogenic activity that characterizes longer ACTH-derived sequences. Because the molecule is small and hydrophilic, it is typically formulated as an aqueous solution for intranasal or parenteral delivery. Acetylation or amidation at the termini appears in closely related research peptides and shifts the mass by a fixed increment.
Reported pharmacological work centers on neurotrophic signaling, including changes in BDNF and NGF expression in hippocampal tissue in animal models. Human data come largely from studies conducted in Russia, and how well those results generalize to other populations remains an open question. Regulatory status differs sharply by jurisdiction: Semax is a registered prescription medicine in Russia, while it holds no approved marketing status in the United States or the European Union. Outside such jurisdictions it is generally handled as a research chemical, which affects both documentation and quality expectations.
Semax is a synthetic heptapeptide whose sequence is Met-Glu-His-Phe-Pro-Gly-Pro. It was developed as a fragment analog of adrenocorticotropic hormone, modeled specifically on the ACTH(4-10) region. The first four residues reproduce that fragment, while a Pro-Gly-Pro tripeptide is appended at the C-terminus. Work on the compound originated in Russia, where it entered clinical use as an intranasal preparation. Its sequence places it among short regulatory peptides studied for effects on the central nervous system rather than on the adrenal axis.
Semax is supplied as a lyophilized powder that appears white to off-white. It dissolves readily in water, phosphate-buffered saline, and other aqueous media, which simplifies preparation of working solutions for laboratory use. The nasal products registered in Russia are dilute aqueous solutions, typically around 0.1 percent peptide by weight. Organic solvents are rarely necessary and can complicate handling. Because the peptide is hygroscopic, weighing should be performed quickly and with minimal exposure to ambient humidity.
Solid material is normally kept at minus 20 degrees Celsius in a sealed, desiccated container. Reconstituted solutions are less stable and are usually divided into single-use aliquots before freezing. Repeated freeze-thaw cycles are avoided because they promote aggregation and loss of activity. Light exposure is minimized by using amber glassware or foil wrapping. Published stability data for this peptide are sparse, so recommended storage conditions rest mainly on general practice for short synthetic peptides rather than on dedicated study.
Semax is a synthetic seven-amino-acid peptide whose sequence extends the ACTH(4-10) fragment with a C-terminal proline-glycine-proline tripeptide. The commonly cited sequence is Met-Glu-His-Phe-Pro-Gly-Pro, giving a molecular formula near C37H51N9O10S and a molecular weight close to 813.9 g/mol. It belongs to the broader class of synthetic ACTH fragments studied for central nervous system effects rather than for adrenal steroid stimulation. In practice the material appears as a lyophilized white powder for laboratory work or as a dilute saline solution in clinical settings.
Development is attributed to researchers at the Institute of Molecular Genetics in Moscow during the early 1980s, building on earlier Soviet work with ACTH fragments. Russian regulatory approval followed for intranasal use, and the compound has remained commercially available there for decades. Most published human data originate from Russian and, later, some Eastern European clinical reports, which are not always accessible in English translation. Outside that region the material is generally handled as a research chemical rather than a licensed medicine.
Regulatory status differs sharply between jurisdictions. In Russia the peptide is registered as a prescription nasal preparation, while agencies such as the United States Food and Drug Administration have not approved it for any indication. Products sold elsewhere are typically labeled for laboratory research only, and such labels shift responsibility for safe handling to the purchaser. Because the same name covers pharmaceutical-grade nasal drops and bulk research powder, identity and purity documentation becomes the main practical concern when comparing sources.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
== References == Cramer, James (1964). The World's Police. London: Cassell. Scouting on Two Continents, by Major Frederick Russell Burnham, D.S.O. LC call number: DT775 .B8 1926. (1926) Radford, M., 1994. Service Before Self, privately published. Gibbs, P., & Phillips, H., 2000. The History of the British South Africa Police, Something of Value Publications, Victoria, Australia. Kent Rasmussen, R., & Rubert, S. C., 1990. Historical Dictionary of Zimbabwe, Scarecrow Press, Metuchen, N.J., US. Brown, Robert K.: American mercenaries in Africa – How to be a Soldier of Fortune in Rhodesia, Soldier of Fortune Magazine, First ever issue 1976. Lott, Jack: "'Run the bastards down!' C.A.T.U. tracks terrorists – Rhodesia's civilian tracking unit". Soldier of Fortune Magazine, July 1979
=== Waterways === Scammonden Reservoir, Deanhead Reservoir – both in the moors near Ripponden River Aire, River Calder, River Hebble, River Spen, River Worth Aire and Calder Navigation Calder and Hebble Navigation Huddersfield Broad Canal Huddersfield Narrow Canal, Standedge Tunnel Leeds and Liverpool Canal Rochdale Canal
This displacement from the intracellular space to the extracellular space moves the DAMPs from a reducing to an oxidizing environment, causing their functional denaturation, resulting in their loss of function. Outside of the aforementioned nuclear and cytosolic DAMPs, there are other DAMPs originated from different sources, such as mitochondria, granules, the extracellular matrix, the endoplasmic reticulum, and the plasma membrane.
== Amino-acid propensities == Different amino-acid sequences have different propensities for forming α-helical structure. Alanine, uncharged glutamate, leucine, charged arginine, methionine and charged lysine have especially high helix-forming propensities, whereas proline and glycine have poor helix-forming propensities. Proline either breaks or kinks a helix, both because it cannot donate an amide hydrogen bond (because it has none) and because its sidechain interferes sterically with the backbone of the preceding turn – inside a helix, which forces a bend of about 30° in the helix's axis. However, proline is often the first residue of a helix, presumably due to its structural rigidity. At the other extreme, glycine also tends to disrupt helices because its high conformational flexibility makes it entropically expensive to adopt the relatively constrained α-helical structure.
Sources: en.wikipedia.org
Initially, pyruvate and thiamine pyrophosphate (TPP or vitamin B1) are bound by pyruvate dehydrogenase subunits. The thiazolium ring of TPP is in a zwitterionic form, and the anionic C2 carbon performs a nucleophilic attack on the C2 (ketone) carbonyl of pyruvate. The resulting intermediate undergoes decarboxylation to produce an acyl anion equivalent (see cyanohydrin or aldehyde-dithiane umpolung chemistry, as well as benzoin condensation). This anion attacks S1 of an oxidized lipoate species that is attached to a lysine residue. In a ring-opening SN2-like mechanism, S2 is displaced as a sulfide or sulfhydryl moiety. Subsequent collapse of the tetrahedral intermediate ejects thiazole, releasing the TPP cofactor and generating a thioacetate on S1 of lipoate. The E1-catalyzed process is the rate-limiting step of the whole pyruvate dehydrogenase complex.
== Prognosis == Mortality in affected felid litters varies between 20 and 100%. Mortality of FPLV is 25–90% in domestic cats with the acute form of the disease and up to 100% in cats with peracute disease. In 2010, a retrospective study of 244 infected cats showed that "leukocyte and thrombocyte counts as well as serum albumin and potassium concentrations at presentation are prognostic indicators in cats with panleukopenia, whereas vaccination status, age, clinical signs, and housing conditions are not." A survival rate of about 50% has been reported with supportive therapies. Cats with FPLV that survive the first five days of treatment usually recover; however, the decrease in the cat's white blood cells compromises its immune system, leaving it vulnerable to secondary infection. Lifelong immunity is thought to follow recovery from disease, and a carrier state of the disease has never been identified.
And when I got it, I didn't miss it." The Astros and Bagwell agreed to a four-year contract on November 23, 1994, worth $27.5 million (USD, $59.7 million today) with the three option years. The average annual value of $6.875 million ($14.9 million today) made him the fifth-highest paid player in the majors.
Florey's portrait appeared on the Australian fifty-dollar note for 22 years between 1973 and 1995. The note also depicted the Sir William Dunn School of Pathology, Penicillin notatum, mice used in penicillin experiments, colonies of mould inhibiting bacterial growth on a Petri dish, and Heatley's assay method. The street of Florey Drive and suburb of Florey in the Australian Capital Territory, the Florey Institute of Neuroscience and Mental Health at the University of Melbourne, Victoria, the Florey Unit of the Royal Berkshire Hospital in Reading, Berkshire, the Florey Institute for Host–Pathogen Interactions at the University of Sheffield, and a lecture theatre in the University of Adelaide's medical school are named after him. The Electoral district of Florey, a single-member electoral district for the South Australian House of Assembly, is also named after him. It was estimated that the development of penicillin saved over 80 million lives.
φ29’s DNA packaging system, using pRNA, incorporates a motor for the delivery of therapeutic molecules like ribozymes and aptamers. The small size of pRNA-derived nanoparticles also helps to deliver drugs in tight spaces like blood vessels. The main difficulty in using aptamer-based drug delivery is sourcing unique aptamers and other multimers for specific treatments for diseases that potentially degrade therapeutic multimers and nanoparticles in vivo. Nanoparticles need to be stabilized as delivery mechanisms in order to adapt to microenvironments that may result in loss of therapeutic cargo.
Sources: en.wikipedia.org
Plants that photosynthesize this carbon also have lower 14C/12C ratios: for example, plants in the neighbourhood of the Furnas caldera in the Azores were found to have apparent ages that ranged from 250 years to 3320 years.
Biosimilar insulins, which have a shorter development timeline of about eight years compared to 12 years for novel biologic drugs, provide a more affordable alternative, with development costs ranging from 10% to 20% of those for new biologics. These products could help improve access to treatment and reduce disparities in insulin availability. The global market for biologic medicines, including insulin, grew from $46 billion in 2002 to $390 billion in 2020, accounting for 28% of the global pharmaceutical market. In the United States, biologics represented 43% of drug expenditures, totaling $211 billion in 2019, with biosimilar spending expected to rise from $5.2 billion in 2019 to nearly $27 billion by 2024. In Europe, biologics accounted for 34% of medicine spending, reaching US$78.6 billion in 2021, with the biosimilar market valued at $8.8 billion. The global human insulin market was valued at $22.9 billion in 2020, while the biosimilar insulin market stood at $2.3 billion, projected to grow to $5.6 billion by 2027. The introduction of biosimilar insulins has increased market competition, offering a cost-effective alternative that could lower treatment costs and reduce strain on healthcare systems. Since the approval of the first biosimilar insulin, interest in the products has increased. However, uncertainty regarding their safety and efficacy has slowed their adoption among healthcare professionals.
=== 2009 === A report prepared for the British House of Lords comes to the conclusion that "The precise circumstances surrounding the August 2008 outbreak of the conflict are not yet clear but responsibility for the conflict was shared, in differing measures, by all the parties. There is evidence of a Russian military build-up prior to the August war." On 17 February 2009, the commanding General of the United States Army Europe Carter Ham commented on the training of Georgian military that the United States had trained the Georgian military for Iraq in the previous years, not for the defense of the homeland against Russia. In May 2009, anonymous European diplomat told The New York Times that NATO officials were told in April 2008 by Russia's defense chief that Georgia would be invaded later that year. In July 2009, Alexander Bastrykin, Chairman of the Investigative Committee of the Prosecutor General's Office, told journalists that the investigation of the war was almost complete. However, the guilt of Georgian president Mikheil Saakashvili in instigating the conflict in South Ossetia could not be proven. In September 2009, first president of the Czech Republic Václav Havel, Otto von Habsburg and other European politicians and thinkers wrote: "First, a big power will always find or engineer a pretext to invade a neighbour whose independence it resents. We should remember that Hitler accused the Poles of commencing hostilities in 1939, just as Stalin pinned the blame on the Finns when he invaded their country in 1940.
Planar cell polarity depends on an asymmetry created by the transmembrane proteins Van Gogh (Vang), Frizzled (Fz), and Flamingo (Fmi), as well as the cytoplasmic proteins Prickle (Pk), Dishevelled (Dsh), and Diego (Dgo). Although the proteins are initially evenly distributed around the cell, through a combination of mutual attraction and repulsion they end up grouped in two clusters at opposite ends of the cell. The proximal end contains bound Vang–Pk complexes, while the distal end contains Fz–Dsh–Dgo. The Vang and Fz proteins are bound together between neighboring cells with Fmi. Depending on the tissue, other protein complexes, such as the Fat–Dachsous (Ft–Ds) system, may also play a role in forming cell polarity. The mechanism by which the polarity direction is initially determined is unclear. The main proposed mechanisms are the concentration gradients of the Ft–Ds system, the noncanonical Wnt signaling pathway, and mechanical forces acting on the shape of the tissue.
Sources: en.wikipedia.org
Dry powder is normally held at -20 °C or lower, away from light and moisture. Sealed vials can also be kept at 2-8 °C for shorter intervals. Warming to room temperature before opening prevents condensation.
In solution, hydrolysis of peptide bonds and oxidation of the methionine residue are the principal concerns. Oxidation converts methionine to its sulfoxide form, shifting the mass by sixteen daltons. Both processes are slowed by cold storage and by avoiding alkaline conditions.
A certificate documents what the supplier measured on a specific lot, not how a laboratory will use the material. Independent verification of identity and purity is common practice. Acceptance criteria should be defined before a batch is ordered.
Registered medical products are most often 0.1% nasal drops. Research suppliers ship lyophilized powder, usually in milligram quantities, which is dissolved before use. The active peptide is the same in both cases; presentation and excipients differ.